О некоторых понятиях генетики и ДНК-генеалогии

В целях просвещения масс, я решил начать серию постов, посвященных базовым понятиям генетики и ДНК-генеалогии. Однако вместо традиционного подхода к объяснению понятий через определения, я решил использовать метод сократической майевтики, то есть ответа на вопрос.

Что такоe снип?

Снип (SNP) -это одиночный нуклеотидный полиморфизм, в генетической систематике относящийся к группе бинарных мутаций UeP (unique event polymorphism, т.е уникальных полиморфных событий).Почему уникальных? Потому что, шанс случайного совпадения аллеля снипа у людей, несвязанных между собой общим происхождением, мал. Правда, существуют отдельные снипы, которые выявлены сразу у нескольких гаплогрупп. Однако эти волатильные снипы не используются для филогенетической классификации ISOGG-дерева Y. Существует отличие и от понятия SNV (single nucleotide variant), но это понятие носит сугубо статистический характер, cнип определяется не просто как вариант, а как полиморфизм в том случае если он встречается у более чем 1% народонаселения.

Что такое DNA strand?

DNA Strand  — это одна из цепочек ДНК (которая комплиментарна по отношению к другой). Обозначается как strand+ и strand-.

Кстати, может быть генетики, которые находятся на форуме, пояснят почему такая путаница со снипами и делециями? Почему для CCR5del32 есть идентификатор характерный для снипов —rs333?
rs333(-;-)
rs333(-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA)
rs333(GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA)

Все просто.
Rs — это обозначение всех полиморфизмов по референсному сиквенсу человека.
Снип -это один из видов полиморфизмов, но, как Вы знаете, есть еще инделы (инсерции + делеции).

В данном случае Delta 32 rs333 обозначает делецию участка ДНК размером в 32 нуклеотид (GTCAGTATCAATTCTGGAAGAATTTCCAGACA)

Проверил — Build36 —   Y   —    6871472   6871966
6871472 Это позиция снипа  L1032. Но счет идет с конца.
Но мало того, эта последовательность не только перевернута, но все T заменены A, а C — G.
Т.е. это другая часть Y-хромосомы.

В Y-сиквенсе геномного билда hg18(Build36) этот регион (495 bp) выглядит следущим образом
>ChrY:6871472..6871966 atctttgggggattggttccaggacctcttgcggatacccaaatgcatgcacactcaaat cctgcagtgtaccctgcaaaacctggtgataggaaaagtcagcactctgtatctggggtt ttgcatcccaaggatactgtattttccttccgaatttgattgtgaatggagaactgagcc ataaggataccaatggtatttattgaaagaaaagtcatgctgtttgattgctgtttgaac cacaaaaaccaagcaaccaaccaaagcccccaaaactaaagctttaaaaaccaatatctg gagaataaaccaaaaccaactaaagcatgaagatggtctaactcagaatgcccagtagaa ctttctaccatatggaaatattttgtatctgtgtagcctcattgccacagctggctaagg gcacaatgggccaagtcatccttactaggcagtgtcagccacactgggccatgtcagcca caccagaccacactg

И, cоотвественно, реверсивная комплиментарная цепочка (strand -)

>ChrY:6871472..6871966 (reverse complemented) cagtgtggtctggtgtggctgacatggcccagtgtggctgacactgcctagtaaggatga cttggcccattgtgcccttagccagctgtggcaatgaggctacacagatacaaaatattt ccatatggtagaaagttctactgggcattctgagttagaccatcttcatgctttagttgg ttttggtttattctccagatattggtttttaaagctttagttttgggggctttggttggt tgcttggtttttgtggttcaaacagcaatcaaacagcatgacttttctttcaataaatac cattggtatccttatggctcagttctccattcacaatcaaattcggaaggaaaatacagt atccttgggatgcaaaaccccagatacagagtgctgacttttcctatcaccaggttttgc agggtacactgcaggatttgagtgtgcatgcatttgggtatccgcaagaggtcctggaac caatcccccaaagat

Праймеры можно сделать по данным Генбанка,затем для пробы (и экономии средств) сделать пару виртуальных ПЦР.
По-моему, даже есть специальные проги для баловства с виртуальными праймерами и виртуальными ПЦР. И только после этого можно ставить реальные ПЦР в лаборатории.

Я так понимаю пункт «Genetic distance» в HIR search и пункт «total CentiMorgans(CM) это одно и тоже, я прав?
И если да, то выходит, что чем больше эта дистанция, тем ближе к тебе оказывается человек, так?

Не факт, что ближе. Вообще, в данном контексте слово дистанция выглядит не очень логично, ибо по логике чем больше «величина» дистанции, тем дальше находятся друг от друга сравниваемые индивиды. В данном случае, генетическая дистанция измеряется в сентиморганах, но сентиморган -это единица не генетической дистанции, а единица измерения расстояния между двумя локусами. При картировании хромосом расстояния между двумя локусами  оценивается путем подсчета количества рекомбинаций на 100 гамет. Это расстояние считается единицей измерения длины гена (а в нашем случае «длины» полусовпадающего участка хромосомы) и называется сентиморганом в честь генетика Т. Моргана, впервые описавшего группы сцепленных генов у плодовой мушки дрозофилы. Если два несинтенических генетическизх локуса находятся на значительном расстоянии друг от друга (т.е величина сM велика), то разрыв между ними будет происходить так же часто, как при расположении этих локусов на разных хромосомах. Поэтому то сентиморган считается также и единицей частоты рекомбинации (или единицей генетического сцепления, что почти одно и то же). Условно говоря 1cM означает 1% вероятности рекомбинаторного события в одном генеалогическом поколении (т.е 1% вероятности того, что при кроссинговере (обмене участками гомологичных хромосом во время конъюгации при мейозе) два локуса на одной хромосоме будут расцеплены друг от друга.

На dna-forums я задавал вопрос о матче в 13 сМ. Мне ответили, что это определённо родство в пределах последних 250-300 лет.

Не факт. Определение дистанции зависит от многих факторов: места, где находится «matching segment», величины LD сегмента (сцепления по неравновесию), воздействием селективного отбора и т.п.

Существуют ли методы оценки достоверности филогении?

Я указал на эти методы в выводах своей работы при интерпретации второй части статьи об ирландцах.
Меня все же терзает вопрос о соотношении понятий неравновесное сцепление/малое генетическое разнообразие выборки. Могут ли тут быть альтернативы. Теоретикам и практикам ДНК генеалогии предлагаю прокомментировать вот эту филогенетическую структуру (в качестве подсказки — предковый гаплотип обозначен литерой C). Размеры кружков пропорциональны количеству гаплотипов. И еще в качестве наводки — представленная популяция статистически незначительно разнообразно, вместе с тем в кластере B наблюдается значительное неравновесное сцепление (но это конечно применимо только к аутосомным гаплотипам).

Что такое Kittler test?

Существуют разные типы тестов Y-STR, в зависимости от структуры и особенностей отделенных локусов. Вот, например, статья, поясняющая как всё не просто с DYS464: http://freepages.genealogy.rootsweb.ancestry.com/~langolier/krahn.pdfТут и переменное число маркеров, и разные последовательности (C-type and G-type), и recLOH конечно. Есть специальные тесты на эти дела, может FTDNA их сделает: DYS464 Extended PCR, DYS464X…

Поясните разницу между снипом и кодоном?

Давайте рассмотрим этот вопрос на примере гена DRD4.  В этом гене определяется  не единичный нуклеотид, а терминаторный кодон (кодирующий тринуклеотид), поэтому говорить о единичном нуклеотидном полиморфизме (снипе) здесь некорректно. Есть  минорный аллель в этом кодоне, присущий финнам, и эта мутация с механизмом выбраса допамина (DRD4). Как показано в научных работах, выброс серотонина тоже вроде связан с тем же геном http://www.jneurosci.org/cgi/content/short/28/11/2933 и http://www.smartplanet.com/technology/blog/rethinking-healthcare/impulsive-it-may-be-a-genetic-mutation/2556/?tag=content;col1

 

 

 

 

Advertisements

Добавить комментарий

Please log in using one of these methods to post your comment:

Логотип WordPress.com

Для комментария используется ваша учётная запись WordPress.com. Выход / Изменить )

Фотография Twitter

Для комментария используется ваша учётная запись Twitter. Выход / Изменить )

Фотография Facebook

Для комментария используется ваша учётная запись Facebook. Выход / Изменить )

Google+ photo

Для комментария используется ваша учётная запись Google+. Выход / Изменить )

Connecting to %s